-Please read each multiple choice, true/false, or short answer question carefully. Answer short-answer questions completely but please be concise. Points maybe deducted for excessive wordiness or if additional information not relevant to the question is given.

-Highlight the correct answer for multiple choice questions in yellow. Also highlight all other answers (short answer, True/False, etc) in yellow.

– You could use the attched “Merged lectures” as a source, or you could use you own sources.

Questions:

List the following in order from smallest to largest based on size of the molecule, region or structure: 1p, 6q26, base pair, chromosome 1, chromosome 22, codon, diploid human genome, exon, gene, haploid human genome, intron, nucleoside, nucleotide, purine base, pyrimidine base
Translation starts and finishes within the portion of the mRNA sequence below from the hypothetical gene, XYZ. Give the predicted amino acid sequence (single-letter or three-letter abbreviations).
CUUGAAUUCUUUGAACGAACAUCGAUGAGUGUUCCAAGAGGGGCACUUCAUCACUAGUCUACCGUCUAU

The gene above is sequenced in a patient A and patient B, both suspected of having a genetic disease caused by mutations in this gene. Describe the variant/mutation found in each patient and classify each with using the following terms when appropriate (SNV, CNV, nonsense, missense, silent, frameshift, in-frame, deletion, insertion, transition, transversion, inversion, translocation, trisomy, monosomy, amplification)
patient A:

CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCATGAGGGGCACTTCATCACTAGTCTACCGTCTAT

patient B:
CTTGAATTCTTTGAACGAACATCGATGAGTGTTCCACGAGGGGCACTTCATCACTAGTCTACCGTCTAT

Based on the information provided in the previous question, is it more likely that patient A or patient B has the genetic disease associated with XYZ? Why?

At a particular locus, how many alleles could you have in common with a sibling (same biological parents)?
1
2
1 or 2
0, 1 or 2

List three components or molecules needed for transcription.
List three ways RNA differs from DNA.

Which best describes “redundancy” of the genetic code?
all organism use the same genetic code
a single amino acid can be coded for by multiple codons
the use of RNA as an intermediate in the genetic code evolved separately in different organisms
The same nucleotide is often repeated several times in the exons of protein coding genes

Which components can be found within exons?
stop codons and introns
promoters and start codons
polyadenylation signal and stop codon
poly-A tail and 5’ untranslated region

Which could be found in an intron?
missense mutation
benign SNV
nonsense mutation
stop codon

Describe the difference between a missense and frameshift variant. What is the impact of each on the DNA sequence and protein sequence?
Which term could be used to describe the variant, “c.135A>C”?
silent
deletion
transition
inversion

Sequencing of cancer tissue reveals a somatic variant/mutation involving a tumor suppressor gene. Which term would most likely describe this variant?
deletion
amplification
silent
chimeric

DNA is extracted from two peripheral whole blood specimens and evaluated by UV spectrophotometry. Give the absorbance measurements below, which sample might be less suitable for PCR testing?
sample #1: 260 nm = 0.85; 280 nm = 1.6
sample #2: 260 nm = 0.61; 280 nm = 0.32

What explanation gives the most convincing explanation for the condition of the less suitable DNA sample in the previous question?
Storage of the DNA samples for more than one month at room temperature
Exposure of the sample to ionizing radiation
Contaminating RNA
Eluting DNA with too much TE buffer
Insufficient washing of magnetic beads during DNA extraction

All of the following are required for both PCR and Southern blotting EXCEPT:
enzyme
hybridization
target amplification
DNA being tested

In traditional (endpoint) PCR, why is testing usually not finished immediately after thermal cycling?

A PCR is performed to amplify a target sequence in genomic DNA prior to Sanger sequencing for 200 different patient samples. The PCR works as expected for all but one sample (John Doe) in which the target sequence did not amplified. Which explanation makes most sense?
John Doe’s DNA sample was isolated from blood drawn in a sodium heparin (green-top) tube.
John Doe’s DNA sample was isolated from frozen tissue
John Doe’s DNA sample became contaminated with PCR product (amplicon) from the last time the same PCR was run
A negative control was not run

List 3 ways the set-up and running of real-time PCR differs from traditional/endpoint PCR.

List 3 things real-time PCR and traditional/endpoint PCR have in common.